Suchergebnisse
Results list
Beetle communities reared from beech branches and associated forest and environmental variables
The data was generated during a landscape experiment performed on 69 plots in Sihlwald forest between 2016 and 2019. Branch bundles of different sizes consisting of beech branches were exposed in the forest for one year to be colonized by saproxylic beetles and later reared for one year in emergence traps. All beetles emerging from the branches were collected. Overall 244 branch bundles are included and we found 66 beetles species (23511 individuals) of which 43 were classified as saproxylic (20873 individuals). Species data (2 tables) Two community matrices (including abundance): one for saproxylic beetles and one for all beetles. Beetles were classfied as saproxylic following an extended list of the list reported in Schmidl & Bussler (2004). Model data (1 table) *Response variables* Species richness and abundance of (saproxylic) beetles. *Branch bundles* Branch bundles consisted of 1, 3, 6 or 12 branches and each bundle size was installed at each of the 69 plots. The bundles consisted of standardized freshly cut beech branches (Fagus sylvatica) with a length of 80 cm and a diameter between 3 and 6 cm. Total surface and volume of each bundle is reported. *Tree on which the bundle was installed* Information on the tree to which the bundles were attached (tree species, dbh, distance and azimut from the plot center). *Temperature and light availability* Temperature (plot level) and light availability (bundle level) were calculated. *Deadwood availability in the landscape* Based on a map of lying dead wood, dead wood amount and isolation were calculated for concentric circles with a radius ranging from 20 to 200 m (in 10 m steps) around each branch bundle. Variable descriptions (1 table)
COSMO-WRF Dataset for Swiss Alps Simulations in Gray-Zone Resolution
This dataset contains simulation data for *"Influence of Air Flow Features on Alpine Wind Energy Potential" (Kristianti et al., 2024).* • The WRF_dia2702 and WRF_dia1103 folders contain the namelist.wps, namelist.input, and output files from the simulation in the Diablerets region on 27/02/2021 and 11/03/2021, respectively. • The WRF_luk2310 and WRF_luk0912 folders contain the namelist.wps, namelist.input, and output files from the simulation in the Lukmanier region on 23/10/2020 and 09/12/2020, respectively. • The postprocessing file contains Python codes used to create figures in Kristianti et al. (2024). **Notes:** • Topography input is provided by Gerber et al. (2021). • Simulations are run using the COSMO-WRF model developed by Gerber et al. (2018). • Visualization by Python code uses wrf-python provided by Ladwig et al. (2017). *This dataset was produced by the EDGE consortium sponsored by the Swiss Federal Office of Energy's SWEET programme, Swiss National Science Foundation (SNSF): Grant 179130, and the Swiss National Supercomputing Centre (CSCS) projects s938, s1115 and s1242.*
Disdrometer Data Gotschnagrat
A laser optical disdrometer (Parsivel² , OTT Hydromet) was deployed at Gotschnagrat (LON: 9.849, LAT: 46.859) to measure hydrometeors by extinction when passing a laser beam. The instrument can classify eight different kinds of precipitation, including rain, hail, snow, drizzle, and hybrid forms. The dataset contains information on precipitation amount and type for the period of February 11 to March 27 2019 at Gotschnagrat.
Monitoring data sets of alpine photovoltaic power-plants
On this repository you can find the monitoring data of the 3 PV power-plants analysed in the article _"Confirmation of the power gain for solar photovoltaic systems in alpine areas"_ (doi: 10.3389/fenrg.2024.1372680) . Each folder contains the following two elements: 1. **README.txt** : describes the content of the folder. Especially it describes the plant's monitoring system's architecture and relates it to the various files included in the data sub-folder. It also provides a detailed description of all processing steps leading to the data sets as available in the data sub-folder and used in the pre-cited article. 3. **data/** : sub-folder containing the file(s) used in the referenced article.
Bettlachstock, Switzerland: Long-term forest meteorological data from the Long-term Forest Ecosystem Research Programme (LWF), from 1997 onwards
High quality meteorological data are needed for long-term forest ecosystem research, particularly in the light of global change. The long-term data series published here comprises almost 20 years of measurements for two meteorological stations in Bettlachstock in Switzerland where one station is located within a natural mixed forest stand (BTB) with European beech (_Fagus sylvatica_; 170-190 yrs), European silver fir (_Abies alba_; 190 yrs) and Norway spruce (_Picea abies_; 200 yrs) as dominant tree species. A second station is situated in the very vicinity outside of the forest (field station, BTF). The meteorological time series are presented in hourly time resolution of air temperature, relative humidity, precipitation, photosynthetically active radiation (PAR) and wind speed. Bettlachstock is part of the Long-term Forest Ecosystem Research Programme (LWF) established and maintained by the Swiss Federal Research Institute WSL.
Comprehensive dataset of pollinator diversity and visitation rates with individual-based traits and pollination success across four urban garden plant species
This dataset contains detailed records of pollinator communities and plant reproductive outcomes from an urban garden experiment in Zurich, Switzerland. It includes flower visitation frequency and pollinator species richness for four insect-pollinated plant species observed across 24 home gardens. The dataset spans 167 pollinator taxa, with over 5,700 individuals identified, mostly to species or genus level. It features individual-level trait measurements for pollinators, such as body size and tongue lengths. Measures of pollination success, including seed and fruit set, are provided for each plant species.
Resolution in species distribution models shapes spatial patterns of plant multifaceted diversity
This dataset comprises a large array of ecological data for the European Alps: (1) Current soil and climate predictors at various resolutions. (2) GBIF observations of the European Alps Flora (~4,000 species). (3) Species habitat suitability maps (1,109 species; based on species observations filtered at 40x40-km) at various resolutions used in the study to generate (4); except 'expert'... (4) Expert, Taxonomic, phylogenetic and functional diversity of the study region at various resolutions (from 100-m to 40-km --> 100-m aggregated & mean to km + non-aggregated/predicted) for CLIM, SOIL and CLIM-SOIL models. (5) Ecological and altitudinal preferences of the European Alps Flora. (6) Data outputs of the related published article. (7) All scripts used for analyses. (8) Additional files used for analyses. (9) Improved set of species habitat suitability maps (~2,600 species; based on species observations filtered at 1x1-km) and related taxonomic diversity at 100-m resolution (aggregated to km + non-aggregated/predicted) for CLIM, SOIL and CLIM-SOIL models ---> not incorporated in the study.
Dataset for: Future water temperature of rivers in Switzerland under climate change investigated with physics-based models
This work presents the first extensive study of climate change impacts on rivers temperature in Switzerland. Results show that even for low emissions scenarios, water temperature increase will lead to adverse effect for both ecosystems and socioeconomic sectors (such as nuclear plant cooling) throughout the 21st century. For high emissions scenarios, the effect will be worsen. This study also shows that water warming in summer will be more important in Alpine regions than in lowlands. This material is distributed under CC BY 4.0 license (https://creativecommons.org/licenses/by/4.0/legalcode).
Environmental DNA Freshwater Switzerland VaudCatchment Modipl 2020
Catchment-based sampling of river eDNA integrates terrestrial and aquatic biodiversity of alpine landscapes From 22-Jun-2020 to 26-Jun-2020, we sampled five sites comprising one low, two intermediate and two high-elevation sites per catchment (Fig. 1a). We visited two catchments per day—one in the morning and one in the afternoon—for a total of ten catchments. All samples per catchment were collected within a maximum four-hour period by three groups of samplers. The intermediate and high-elevation sites were situated along two tributaries leading into the low-elevation site of the river. We used three filters for each relative elevation class and filtered 60 L per relative elevation class. We sampled 30 L per tributary for a combined volume of 60 L at the intermediate and high-elevation sites. In total, 180 L were sampled in total per catchment. A filtration device composed of either the Athena® peristaltic pump (Proactive Environmental Products LLC; 1 L/min nominal flow) or the Subspace® underwater peristaltic pump (Subspace Pictures; 1 L/min nominal flow), combined with a VigiDNA® 0.2 µM cross-flow filtration capsule (VigiDNA, SPYGEN) was used in order to filter a large water volume. We used a finer mesh than the recommended VigiDNA® 0.45 µM cross-flow filtration capsule to maximise the capture of biological material since mountain water does not transport high quantities of sediments. For each filtration capsule, we used disposable sterile tubing. At the end of each filtration, we emptied the water inside the capsules, replaced it with 80 ml of CL1 conservation buffer (SPYGEN), and stored it at room temperature. We followed a strict contamination control protocol in both field and laboratory stages (Goldberg et al. 2016; Valentini et al. 2016). Each water sample was processed using disposable gloves and single-use filtration equipment. We used two primer sets targeting vertebrates (Vert01, forward: − TTAGATACCCCACTATGC, reverse: − TAGAACAGGCTCCTCTAG, mean marker length: 97 bp) and spermatophytes (g-h/Sper01, forward: − GGGCAATCCTGAGCCAA, reverse: CCATTGAGTCTCTGCACCTATC, mean marker length: 48 bp). Though both primers are relatively broad with low species-level resolution, we selected them as the goal was to minimise cost and effort and maximise the identification of a broad range of taxa which can represent the species assemblages of the region. Libraries were prepared with ligation using the MetaFast protocol (Fasteris).
Swiss FluxNet Site Lägeren
The Swiss FluxNet Site Lägeren is a managed mixed deciduous mountain forest located on the steep Lägeren mountain (NW of Zurich, Swiss Plateau). The forest is highly diverse, dominated by beech, but also including ash, maple, spruce and fir trees. Eddy covariance flux measurements were started in April 2004. The site was part of the international CarboEurope IP network and the National Air Pollution Monitoring Network (NABEL). In addition to Swiss FluxNet, the site is part of the Long-term Forest Ecosystem Research (LWF) of WSL and the biological drought and growth indicator network (TreeNet) of WSL. Measurements - Ecosystem flux measurements of CO2, H2O vapour are performed with the eddy-covariance method. This method is based on measurements of trace gas mixing ratios, using infrared gas analyzers (for CO2, H2O vapor), combined with wind speed and wind direction measurements, using 3D sonic anemometers. To resolve the short-term turbulent fluctuations in the atmosphere, very fast measurements are needed: we measure at 10-20 Hz, i.e., 10-20 times per second. To assess the energy budget of each ecosystem, also radiation sensors and soil climate profiles are installed at the site. - Sub-canopy eddy fluxes (CO2, H2O), soil respiration campaigns - Continuous CO2 profile measurements. - Auxiliary micrometeorology and soil climate measurements. Data availability All data are available from the European Fluxes Database Cluster, but are also part of Fluxnet2015 dataset. Data policy ICOS data license: [https://www.icos-cp.eu/data-services/about-data-portal/data-license](https://www.icos-cp.eu/data-services/about-data-portal/data-license) Detailed site info: [https://www.swissfluxnet.ethz.ch/index.php/sites/ch-lae-laegeren/site-info-ch-lae//](https://www.swissfluxnet.ethz.ch/index.php/sites/ch-lae-laegeren/site-info-ch-lae/)